Skip to main content

Advertisement

Table 2 Oligonucleotide sequences for siRNA primers

From: Induction of active demethylation and 5hmC formation by 5-azacytidine is TET2 dependent and suggests new treatment strategies against hepatocellular carcinoma

Gene Name Target sequence 5′ or 3′ Mod
Control Scrambled siRNA 5′AACAGTCGCGTTTGCGACTGG3′ 3′ FLU
TET2 TET2-siRNA 5′CAAGACCAATGTCAGAA 3′ 3′ FLU
TET3 TET3-siRNA 5′GATGAAGGTCCATATTA 3′ 5′ CY3