Skip to main content

Advertisement

Table 4 Primers used for PCR methods

From: Vitamin and antioxidant rich diet increases MLH1 promoter DNA methylation in DMT2 subjects

Primer name Sequence 5′-3′ Application Size Number of CpGs Ref
MLH1-C-FW GTATTTTTGTTTTTATTGGTTGGATA COBRA 294 bp 1 [24]
MLH1-C-RE AATACCTTCAACCAATCACCTCAATA COBRA    
MLH1-1-FW GGAGAGGAGGAGTTTGAGAAG PSQ 269 bp 7  
MLH1-1-RE Biotin-AATACCAATCAAATTTCTCAACTCTAT PSQ    
MLH1-1-Seq TTGTTTTTATTGGTTGGATAT PSQ    
MGMT-FW Biotin-GGATATGTTGGGATAGTT PSQ 266 bp 5 [42]
MGMT-RE AAACTAAACAACACCTAAA PSQ    
MGMT-Seq CCCAAACACTCACCAAA PSQ    
MLH1-Q-FW TTCTCAGGTTATCGGAGCCAGCAC qRT-PCR 288 bp   [43]
MLH1-Q-RE CTTCGTCCCAATTCACCTCAGTGG qRT-PCR    
DNMT1-Q-FW ACCGCTTCTACTTCCTCGAGGCCTA qRT-PCR 335 bp   [44]
DNMT1-Q-RE GTTGCAGTCCTCTGTGAACACTGTGG qRT-PCR    
GAPDH-Q-FW CGACCACTTTGTCAAGCTCA qRT-PCR 205 bp   [45]
GAPDH-Q-RE AGGGGTCTACATGGCAACTG qRT-PCR    
  1. COBRA, combined bisulfite restriction analysis: PSQ, pyrosequencing: qRT-PCR, quantitative real-time reverse-transcriptase polymerase chain reaction; Ref, reference.